The following sequence shows a bacterial gene starting +1 (transcription initiation site). Promoter Show more The following sequence shows a bacterial gene starting +1 (transcription initiation site). Promoter sequence is not shown.

The following sequence shows a bacterial gene starting +1 (transcription initiation site). Promoter Show more The following sequence shows a bacterial gene starting +1 (transcription initiation site). Promoter sequence is not shown.

The top strand is in 5 to 3 direction and the bottom strand is in 3 to 5 direction. ATTGTGAGCGGATAACAATGTCACACAGGAAACAGCTAAGACCATGTTT -+-+de+f-c++ TAACACTCGCCTATTGTTACAGTGTGTCCTTTGTCGATTCTGGTACAAA i). Write the sequence of mRNA produced from this DNA. ii) What are the first six amino acids of the resulting protein? Use genetic code table from your book. iii) Does translation terminate at the underlined TAA at position (c bold)? Why or why not? iv) How would your answer to ii) if you replace the nucleotide C (indicated with bold d) with a G. v) What would be the first six amino acids if you deleted the nucleotide C (indicated with bold d)? Also would the underlined TAA at position (c bold) result in termination of polypeptide synthesis. What kind of mutation would this represent? vi) How would your answer to if you change nucleotide A (indicated with f bold) with a G. What kind of mutation would this represent? Show less

Having Trouble Meeting Your Deadline?

Get your assignment on The following sequence shows a bacterial gene starting +1 (transcription initiation site). Promoter Show more The following sequence shows a bacterial gene starting +1 (transcription initiation site). Promoter sequence is not shown. completed on time. avoid delay and – ORDER NOW

Explanation & Answer

Our website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of HIGH QUALITY & PLAGIARISM FREE. To make an Order you only need to click Order Now and we will direct you to our Order Page at Litessays. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.

Fill in all the assignment paper details that are required in the order form with the standard information being the page count, deadline, academic level and type of paper. It is advisable to have this information at hand so that you can quickly fill in the necessary information needed in the form for the essay writer to be immediately assigned to your writing project. Make payment for the custom essay order to enable us to assign a suitable writer to your order. Payments are made through Paypal on a secured billing page. Finally, sit back and relax.

Do you need an answer to this or any other questions?

Similar Posts