This assignment is due on Tuesday February 20th in lab by 11:21AM. Give yourself enough time to print out your assignment in case you have printer problems. I will not accept electronic copies. Hardcopies only, and late assignments are not accepted in the biology department.
This assignment is due on Tuesday February 20th in lab by 11:21AM. Give yourself enough time to print out your assignment in case you have printer problems. I will not accept electronic copies. Hardcopies only, and late assignments are not accepted in the biology department.
During transcriptional initiation RNA polymerase holoenzyme recognizes the consensus sequences within the promoter of coli. What part of the RNA polymerase holoenzyme recognizes the consensus sequence?
Having Trouble Meeting Your Deadline?
Get your assignment on This assignment is due on Tuesday February 20th in lab by 11:21AM. Give yourself enough time to print out your assignment in case you have printer problems. I will not accept electronic copies. Hardcopies only, and late assignments are not accepted in the biology department. completed on time. avoid delay and – ORDER NOW
Does RNA polymerase holoenzyme recognize the sense, or antisense strand? The antisense strand is used for what purpose during transcription?
A single strand of bacterial DNA contains the base sequence
-35 -10 +1
5’ CGTGTATTGACACTGGTGAGCCACTATCGTATATTCCCTAAGTGAGTATTGG 3’
What is the complementary sequence? Draw or type this sequence just below and indicate its polarity (directionality) in order to create a double-stranded DNA sequence.
Under the double-stranded DNA sequence, draw or type the mRNA sequence that will be translated, and indicate its polarity.
Which strand of the DNA serves as the coding strand, and which serves as the template strand, for the synthesis of the RNA transcript for this hypothetical gene fragment.
If a stop codon is not included in the mRNA molecule, how would this affect the following:
translocation on the mRNA by polyribosomes
concentration of this specific polypeptide in the cell
How many different types of tRNA molecules exist in the cell? For what purpose (hint: why are there 20 different tRNA molecules)?
Explanation & AnswerOur website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of HIGH QUALITY & PLAGIARISM FREE. To make an Order you only need to click Order Now and we will direct you to our Order Page at Litessays. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.
Fill in all the assignment paper details that are required in the order form with the standard information being the page count, deadline, academic level and type of paper. It is advisable to have this information at hand so that you can quickly fill in the necessary information needed in the form for the essay writer to be immediately assigned to your writing project. Make payment for the custom essay order to enable us to assign a suitable writer to your order. Payments are made through Paypal on a secured billing page. Finally, sit back and relax.