You were able to isolate and sequence the following section of bacterial DNA and you have evidence t Show more You were able to isolate and sequence the following section of bacterial DNA and you have evidence that you generated the sequence for the sense strand of the gene.

You were able to isolate and sequence the following section of bacterial DNA and you have evidence t Show more You were able to isolate and sequence the following section of bacterial DNA and you have evidence that you generated the sequence for the sense strand of the gene.

The protein produced from this DNA molecule is very short only 4 amino acids long. 5AAATTGACACCTAATTCGGCGCTATCTTATAATCGTGCCTGTATGTTTCGTCGTTAA3 A) [2 points] Find highlight and label the functional DNA bases in the above gene that determine transcription and translation. B) [2 points] What kind of transcription factor binds to the DNA bases you found on the 5 end of the above gene and what role does it play? C) [2 points] Write out the sequence for the antisense strand of the above sequence. D) [2 points] Write out the coding portion of the RNA transcript that will be produced by RNA polymerase for the above gene segment. E) [2 points] What will be the 4 amino acid sequence of this polypeptide? Show less

Having Trouble Meeting Your Deadline?

Get your assignment on You were able to isolate and sequence the following section of bacterial DNA and you have evidence t Show more You were able to isolate and sequence the following section of bacterial DNA and you have evidence that you generated the sequence for the sense strand of the gene. completed on time. avoid delay and – ORDER NOW

Explanation & Answer

Our website has a team of professional writers who can help you write any of your homework. They will write your papers from scratch. We also have a team of editors just to make sure all papers are of HIGH QUALITY & PLAGIARISM FREE. To make an Order you only need to click Order Now and we will direct you to our Order Page at Litessays. Then fill Our Order Form with all your assignment instructions. Select your deadline and pay for your paper. You will get it few hours before your set deadline.

Fill in all the assignment paper details that are required in the order form with the standard information being the page count, deadline, academic level and type of paper. It is advisable to have this information at hand so that you can quickly fill in the necessary information needed in the form for the essay writer to be immediately assigned to your writing project. Make payment for the custom essay order to enable us to assign a suitable writer to your order. Payments are made through Paypal on a secured billing page. Finally, sit back and relax.

Do you need an answer to this or any other questions?

Similar Posts